TikTok Shop Logo
Shop
Download appPromo codesSitemapTikTok Shop global websites
Sell
Seller Center
About
Contact usCareersAffiliate
Customer support
TikTok Shop protectionsReturn policyBuyer policyFinal saleCommunity guidelines
Legal
Terms of ServicePrivacy Policy
Discover
DR.RAMAY Skin Care Remover Gel , Exfoliating Body Cream for Rough Skin, Gentle Face & Body MoisturizerHalter V-Neck Ruched Yoga Set - 33+ Colors, Seamless 2-Piece Outfit with Removable Cups, Tummy Control High Waist & Scrunch Booty Lifting Shorts | Buttery Soft, Squat-Proof, Breathable Activewear for Gym, Yoga & Everyday WearDRMTLGY Physical Tinted Moisturizer SPF44 2 fl oz Water-Resistant SunscreenShirley Women's Quilted Chain Tote Bag – Affordable Vegan Leather, Classic Flap Shoulder Bag for School and Work – Stylish Everyday Tote, Perfect Gift for Women in Multiple ColorsYes You Can! Detox Plus Kit - Natural Detox System with Artichoke Broccoli Thistle Seed Extracts, Aloe Vera, High Fiber/ Meal Replacement, Shake Booster, Aloe vera, Detox Supplement Dietary HealthcareMeowant SC09 Smart Automatic Large Self-Cleaning Cat Litter Box, 106L Extra-Large Space, APP Control, Odor Removal, Anti-Pinch Design, Easy Installation for Multiple Cats, Smart Litter Box, Automatic Litter BoxEomenie One Piece Swimdress Swimsuits for Women Tummy Control Swim Dresses Bathing Suits Swimwear Swimsuit Slimming Beachwear onepieceswimsuit68800mAh Solar Charger Power Bank, Wireless Charger with 4 Built-in Cables & 7 Outputs, 15W Fast Charging Battery Pack with Dual Flashlights and Compass for Mobile Devices,external backup battery pack fathersdaygiftGGIRL 18K Gold Plated Puerto Rico Flag Oil Drop Stainless Steel Pendant Necklace For Men and Women National Flag Map Series Pendant Necklace Fashion Black Friday Christmas National Enthusiasts Jewelry Giftsgreen panDachic Hair 180% Density 13x6 HD Transparent 613 Blonde Straight Wigs 40 Inch Lace Frontal Hot Red Colored Human Hair Wigs 99J Burgundy Wig Brazilian Blonde Body Wave Wig 13x4 Lace Front Ginger Blonde Hair WigsGlitter Dumpling Squishy with Box, Soft Sensory Squeeze Toy for Stress Relief, Mystery Glitter Dumplings, Decompression Dough, Not Blind Box, You Can Choose Your Favorite Color Freely summerwinsOluck Perfume M7 (Gulf Night) Cologne for Women & Men, Lemon Pineapple Nutmeg Cedarwood Vanilla Notes, Middle Eastern FragranceFLEXTAIL 1.2oz ZERO PUMP Ultra-Mini Electric Air Pump, Outdoor Essentials, Portable Air Mattress Pump, Rechargeable Air Pump for Pool Floats Air Bed, Multiple nozzle adapters, Inflatable Airbed, Camping Accessories Sleep Sack Quick InflateSEEUO 10/12/14 Inch Hybrid Mattress, Gel Memory Foam & Pocket Spring in a Box, Twin/Full/Queen/King, Medium Firm, Back Support, Motion Isolation, Firm EdgeElite Gourmet EGC115M Easy Egg Cooker Electric 7-Egg Capacity, Soft, Medium, Hard-Boiled Egg Coo...Colorfulkoala Dreamlux No Front Seam Capri Leggings for Women 21" Inseam, High Waisted Yoga PantsPlus Size Ethnic Pattern Embroidered Split Kaftan Dress, Boho Notched Neck Batwing Sleeve Long Dress, Summer Clothing, Women's Summer Clothes, Modest Clothing Caftan Robe, Muslim Women Gowns, Modesty Muslim ClothingAlLAlSHI Bond & Seal 2 in 1 Cluster Lash Glue Black/White, Waterproof, Long-Lasting Strong Hold Eyelash Adhesive, DIY Lash Extensions Glue for Individual Cluster Lashes, Dual Purpose Lash Bond and Seal for Self-Application,WeeklyDeals, DealsForYouDaysBlack LA Dodgers New Era 59FIFTY Fitted Baseball Cap – Flat Brim Baseball Hat, White Embroidered LA Logo, Premium MLB Streetwear Stylegods love overcomesWomen's Solid Color Button Front Cardigan, Casual Long Sleeve Knitwear for Spring & Fall, Fashion Women's Knit Clothing for Daily WearNew 3D Cartoon Stress Relief Toy, Realistic Rubik's Cube Squeeze Toy, Infinite Stress Relief, Perfect for Anxiety Reduction, Fidget Relief, Decompression Squeeze.Valentine's Day and Easter gifts, suitable forchildren to exchange gifts【Flat Bottom ONLY】Cordless Robotic Pool Cleaner, Lasts 90 Min, Automatic Vacuum for Above-Ground Pools up to 860 Sq.ft, Pool Vacuum, Portable, Self-Parking #FathersDayGift #smartlivingANRABESS Womens Half Sleeve Crewneck Tops Ribbed Knit Slim Fit Shirts Basic Tee 2026 Spring Summer Dressy Casual T-ShirtsWIHOLL FASHION SwimWeek Womens Summer Tops Short Petal Sleeve Shirts Fashion V Neck Outfits Clothes Blouse CasualDOBREVA Women's Balconette Sexy Unlined Bra Lace Push Up Plus Size Bras See Through UnderwireThe VOCABULARY R.A.P. CAMP Dictionary: Advance (C2) Vocabulary Word StudyOne yellow striped double-layer protective case, a sturdy and durable 2-in-1 protective case, compatible with iPhone 17/16/15/14/13/12/11 Pro Max/Plus/Pro, and Samsung Galaxy S25/S24/S23 Ultra series. Suitable for couples.Bedroom Pedestal Fan, Quiet 20dB DC Air Circulator, 15 Speeds 5 Modes, 120° Oscillation, 12H Timer, 1050CFM Airflow, 37-45" Adjustable Height, LED Light, Standing Fan with RemoteBling Hair Glueless Wig Human Hair Deep Wave 6x4 5x5 Pre Cut Lace Wig Human Hair Ready To Wear Lace Closure Wigs for Women 13x4 13x6 Transparent Lace Front Wig #TikTokShopFallDealsForYou #TikTokShopHolidayHaulCrocs Womens On The Clock Sneaker Slip Resistant Work ShoesChicMe Built-in Bra Tank Tops U Neck Camisole High Strechy Seamless Women Going Out Tops Everyday Basic Tanks Padded Tops2026/2027 Rand McNally Road Atlas & National Park Guide -- Rand McNally, Paperback"Orbiter" Noah Kahan The Great Devide Shirt, "I'm An Astronaut You're The Moon" Graphic Tee - Vintage Star Moon Aesthetic Oversized Washed Shirt, Gift For Music Fan, Noah Kahan LyricsClarks Collection Leather Strappy Heeled Sandals -Seannah Madi4 in 1 Travel Pump Dispenser Bottle, 30ML 4 Pack Leak-Proof Pump Containers with Measurement Scale & Label Stickers, Portable Bottles for Toiletries, Shower & Travel UseIntex Inflatable Kids Dinosaur Play Center Outdoor Water Park Pool with SlideBearbro Multi-Functional FID Weight Bench for Full All-in-One Body Workout – Hyper Back Extension, Roman Chair, Adjustable Ab Sit up Bench, Incline Decline Bench, Flat Bench,Support up to 1000lbs,Suitable for home workouts,outdoorfun[medicube] PDRN Pink Collagen Gel Mask 4 Sheets Salmon DNA Color Changing Pink Glow Collagen Facial Mask Korean SkincareLZDJTQ 36PCS Steel Needles Set - Long & Thin Handmade Quilting & Sewing Needles Kit for DIY Sewing ProjectsHolafish Women's Acid Washed Short-Sleeve Graphic T-Shirt - Daisy Print, Drop Shoulder, Baggy Fit, Comfortable Casual Streetwear Clothing, Shortsleeve[Dr.Melaxin Official] TX Serum Rx | Niacinamide & TXA Dark Spot Brightening Synergy | Korean Skincare | 1.01fl.oz (30ml)Cider Cotton-blend Polka Dot Capri Jumpsuit SwimWeekThick Thighs and Sleep Deprived Shirt, Comfort Colors, Muscle Mommy, Pump Cover T Shirt, Weightlifting Shirt, Work Out Shirt, Gym Pump CoverLattafa Asad for Men Eau de Parfum Spray, 3.4 OunceEF ECOFLOW Delta 3 Series Smart Extra Battery, 1024Wh LiFePO4 Expansion Battery for Power Station Delta 2/Delta 3/Delta 3 Plus/Delta 3 15004-Pack Men’s Summer Shorts – 3/4 length, casual loose fit, versatile athletic straight cut for running, walking, and hikingweikechen shopCute Checker Personalized Kids Graduation Stole, Custom Name Kindergarten Sash Class of 2026, Checker Adorable Preschool Grad Gift, Cute Preschool Stole Class Grad
FAQ
What Is TikTok Shop and How Do I Access It?
TikTok Shop is an integrated e-commerce platform within the TikTok app , allowing users to discover and purchase products directly from videos, live streams, and creator profiles.
How to Access:
  • In-App: Open TikTok and tap the "Shop" tab or the shopping bag icon.
  • Through Videos: Click on product links showcased in videos.
  • Profile Storefronts: Visit a seller's profile and tap on their "Shopping" tab.
Keywords:
  • TikTok Shop
  • TikTok Shop App
  • TikTok Shop Login
  • How to Look Through TikTok Shops
How Do I Get TikTok Shop Promo Codes and Free Shipping?
To obtain TikTok Shop promo codes and free shipping codes:
  • Follow Official Accounts : Keep an eye on TikTok Shop's official promotions.
  • Engage with Creators: Influencers may share exclusive promo codes during live streams.
  • First Order Discounts: New users often receive a promo code for the first order.
  • Seasonal Sales: Look out for discounts during holidays.
Keywords:
  • TikTok Shop Promo Code
  • TikTok Shop Free Shipping Code
  • TikTok Shop Promo Code First Order
  • TikTok Shop Gift Card
Is TikTok Shop Safe and Legitimate to Buy From?
Yes, TikTok Shop is safe and legitimate. It provides secure payment options and verifies sellers to protect buyers.
Tips for Safety:
  • Purchase from verified sellers with positive reviews.
  • Read product descriptions carefully.
  • Use secure payment methods within the app.
Keywords:
  • Is TikTok Shop Safe
  • Is TikTok Shop Legit
  • Can You Trust TikTok Shop
How Do I Sell on TikTok Shop?
To start selling on TikTok Shop:
  1. Register as a Seller:
    • Visit the TikTok Shop Seller Center .
    • Sign up using your TikTok account or email.
  2. Provide Business Information:
    • Submit necessary documents for verification.
  3. List Your Products:
    • Add product details and images.
  4. Promote Your Products:
    • Use videos, live streams, and the TikTok Shop Affiliate Program .
Keywords:
  • How to Sell on TikTok Shop
  • TikTok Shop Seller
  • TikTok Shop Creator
Can I Sell Digital Products on TikTok Shop?
Currently, TikTok Shop primarily supports physical products. To sell digital products:
  • Check Policies: Review the latest guidelines in the Seller Center .
  • Compliance: Ensure digital products meet TikTok's standards.
Keywords:
  • Can You Sell Digital Products on TikTok Shop
  • TikTok Shop Policies
How Do I Add a TikTok Shop Link to My Video?
To add a shop link to your TikTok video:
  • Create Your Video: Record and edit as usual.
  • Add Link Before Posting:
    • Tap on "Add Link".
    • Select "Product".
    • Choose the item from your TikTok Shop listings.
  • Post Your Video: The product link will appear on your video.
Keywords:
  • How to Add TikTok Shop Link to Video
  • TikTok Shop Integration
How Do I Connect Shopify to TikTok Shop?
To connect your Shopify store:
  1. Install TikTok App on Shopify:
    • Go to Shopify App Store.
    • Install the TikTok channel app.
  2. Link Accounts:
    • Follow prompts to connect TikTok and Shopify.
  3. Sync Products:
    • Select products to feature on TikTok Shop.
  4. Set Up Tracking:
    • Install TikTok Pixel for analytics.
Keywords:
  • How to Connect Shopify to TikTok Shop
  • Shopify TikTok Shop Integration
How Long Does TikTok Shop Take to Deliver and Can I Track My Order?
Delivery times vary depending on the seller and shipping method.
  • Estimated Delivery:
    • Provided at checkout or in order details.
  • Order Tracking:
    • Go to "Orders" in TikTok Shop.
    • Select your order to view tracking information.
Keywords:
  • How Long Does TikTok Shop Take to Deliver
  • TikTok Shop Order Tracking
Why Is TikTok Shop So Affordable?
TikTok Shop often offers lower prices due to:
  • Direct Sales Model:
    • Sellers can reduce costs by selling directly to consumers.
  • Promotions and Discounts:
    • Frequent sales events and promo codes.
  • High Competition:
    • Sellers compete on price to attract buyers.
  • Keywords:
    • Why Is TikTok Shop So Cheap
    • TikTok Shop Deals
    What Is the TikTok Shop Return Policy and How Do I Cancel an Order?
    • Return Policy:
      • Varies by seller, but generally allows returns within 14-30 days.
      • Items must be unused and in original packaging.
    • How to Return:
      • Go to "Orders".
      • Select the item and initiate a return.
    • Canceling an Order:
      • If the order hasn't shipped, you can cancel it from the order details page.
    Keywords:
    • TikTok Shop Return Policy
    • How to Cancel TikTok Shop Order
    • TikTok Shop Refunds
    © 2026 TikTok
    1. TikTok Shop
    2. Shop All Categories
    3. activactactactactactactactactact

    Results for activactactactactactactactactact

    Activator Spray (13.5 Fl Oz), Instant Cure Accelerator for Cyanoacrylate (CA) Super Glue for , Plastic, Rubber, Granite, and DIY  Professional, Accelerates Bonding Strength, (2 Pack)

    Activator Spray (13.5 Fl Oz), Instant Cure Accelerator for Cyanoacrylate (CA) Super Glue for , Plastic, Rubber, Granite, and DIY Professional, Accelerates Bonding Strength, (2 Pack)

    1 sold
    Limited time deal
    $2.60
    Lacoste Elite Active 225 1 SMA - 750SMA0075-APK
    Free shipping

    Lacoste Elite Active 225 1 SMA - 750SMA0075-APK

    5.0
    23 sold
    $140.00
    AURA Pro 2
    Free shipping

    AURA Pro 2

    5.0
    5 sold
    -20%$95.96$119.95
    ACTA Evo 5" Biker Short Ultra-Stretchy Soft High Waist Fit Power-Hold Waistband Squat-Proof Workout Shorts in Black
    Free shipping
    ACTA Wear

    ACTA Evo 5" Biker Short Ultra-Stretchy Soft High Waist Fit Power-Hold Waistband Squat-Proof Workout Shorts in Black

    5.0
    60 sold
    $50.00
    CA Glue with Activator - High-Quality Glue for Various Applications
    Free shipping

    CA Glue with Activator - High-Quality Glue for Various Applications

    4.4
    449 sold
    $16.99
    STRESS HIM OUT SWEATPANT IN GREY
    Free shipping
    AKIRA

    STRESS HIM OUT SWEATPANT IN GREY

    3 sold
    $55.90
    ACTA Evo Twist Bra - Lightweight & Breathable No Pads Super Stretchy with Twisted Front & Sturdy Straps for Unique Style Yoga Workout Activewear Yoga Gym Activewear Fitness Clothes
    ACTA Wear

    ACTA Evo Twist Bra - Lightweight & Breathable No Pads Super Stretchy with Twisted Front & Sturdy Straps for Unique Style Yoga Workout Activewear Yoga Gym Activewear Fitness Clothes

    13 sold
    $40.00
    ADAPT Series Balaclava

    ADAPT Series Balaclava

    4.8
    66 sold
    $24.99
    Active Sweatpants & hoodie set

    Active Sweatpants & hoodie set

    5.0
    6 sold
    $59.99
    ACTA Evo 4" Biker Short Ultra-Stretchy Soft High Waist Fit Power-Hold Waistband Squat-Proof Workout Shorts in Black
    Free shipping
    ACTA Wear

    ACTA Evo 4" Biker Short Ultra-Stretchy Soft High Waist Fit Power-Hold Waistband Squat-Proof Workout Shorts in Black

    5.0
    32 sold
    $50.00

    Recommended for you

    Clean Nutra Circulation Power Trio | Cayenne Pepper, Tongkat Ali, MACA Root & More for Vitality, Blood Flow & Endurance Liquid Drops [Vascu Glow + AlphaRoots + AdaptoDrive]
    Clean Nutra

    Clean Nutra Circulation Power Trio | Cayenne Pepper, Tongkat Ali, MACA Root & More for Vitality, Blood Flow & Endurance Liquid Drops [Vascu Glow + AlphaRoots + AdaptoDrive]

    4.7
    3.0K sold
    Limited time deal
    $56.33
    Cata-Kor Skin, Hair & Nails Supplement – Ca AKG | MSM | Hyaluronic Acid | Biotin – Supports Radiant Skin, Promotes Shiny Hair & Strong Nails – Beauty Complex, Dietary Supplement
    Free shipping
    Cata-Kor USA

    Cata-Kor Skin, Hair & Nails Supplement – Ca AKG | MSM | Hyaluronic Acid | Biotin – Supports Radiant Skin, Promotes Shiny Hair & Strong Nails – Beauty Complex, Dietary Supplement

    4.7
    48.6K sold
    -38%$27.99$44.99
    AZALEA WANG SELIE WHITE FLAT SNEAKER
    Free shipping
    AKIRA

    AZALEA WANG SELIE WHITE FLAT SNEAKER

    4.6
    4.8K sold
    $79.90
    ACTIVE Washing Machine Cleaner for Pet Owners Enzymatic Deep Clean Descaler
    Free shipping
    USEACTIVE

    ACTIVE Washing Machine Cleaner for Pet Owners Enzymatic Deep Clean Descaler

    4.6
    19.1K sold
    Limited time deal00:00:00
    -14%$24.98$28.98
    Audien Atom ONE OTC Hearing Aids for Adults – Discreet In-Ear Sound Amplification, Rechargeable, No Prescription
    Free shipping
    Audien Hearing

    Audien Atom ONE OTC Hearing Aids for Adults – Discreet In-Ear Sound Amplification, Rechargeable, No Prescription

    4.1
    33.0K sold
    Limited time deal
    $98.00
    Related Searches
    activeactactactactactactactactact
    activactiveactactactactactactactact
    activities for kids
    active active active active active
    Related Categories
    Adhesives, Tapes & Sealers
    Casual Trainers
    Smart Watches
    Sports Shorts
    Jeans
    Sports Bras
    Face Covers & Mask
    Sports Clothing Sets
    Sports Tops